Skip to main content

Table 1 Primers Design, Sequences and Amplification programs for Polymerase Chain Reaction

From: Possible roles of Epstein-Barr virus in Castleman disease

Target Sequence (5' to 3') 1 2 3 4 5 6  
β-globin         
   PC03 ACACAACTGTGTTCACTAGC 94°C 94°C 55°C 72°C 72°C 4°C  
   PC04 CAACTTCATCCACGTTCACC 5 min 30 sec 40 sec 1 min 8 min   2~4 35 cycle
EBV         
   EBNA-2(F) AGGCTGCCCACCCTGAGGAT 94°C 94°C 56°C 72°C 72°C 4°C  
   EBNA-2(R) GCCACCTGGCAGCCCTAAAG 5 min 1 min 1 min 1 min 10 min   2~4 35 cycle
   EBER(F) GTGGTCCGCATGTTTTGATC 94°C 94°C 58°C 72°C 72°C 4°C  
   EBER(R) GCAACGGCTGTCCTGTTTGA 5 min 30 sec 1 min 2 min 10 min   2~4 35 cycle
  1. EBV: Epstein-Barr virus, EBNA: Epstein-Barr Nuclear Antigen, F: forward, R: reverse
\