Skip to main content

Table 1 Primer pairs that have been used in PCR

From: Bacterial and fungal microflora in surgically removed lung cancer samples

Organism Species Forward Primer (5'-3') Reverse Primer (5'-3') PCR Product (bp)
Treponema pallidum AATGCGGTGGCGTAGCGATAC TTTTGCGGTTTGCTCCACTTC 275
  denticola AGGGATATGGCAGCGTAGCAATA CGTCCTCCCTTACGGGTTAGACT 453
  vincentii GCGGTATGTAAGCCTGGTGTGAA TTTGCTTTGGCACTGAAGCTCTT 277
Neisseria meningitidis AAGTCGGACGGCAGCACAGA TCAGCCGCTGATATTAGCAACAG 421
Legionella pneumophila AAGATTAGCCTGCGTCCGATTAG AACCCTCCTCCCCACTGAAAGT 232
Borrelia burgdorferi CATGCAAGTCAAACGGGATGTA GACCTTCTTCATTCACGCAGTG 361
  americana    
  valaisiana    
  garinii    
  recurrentis    
  hispanica    
  duttonii    
  lusitaniae    
  spielmanii    
Listeria grayi TCTTGACATCCTTTGACCACTCTG TGCACCGGCAGTCACTTTAGAG 157
  innocua    
  monocytogenes    
  welshimeri    
Helicobacter pylori GATTGGCTCCACTTCGCAGTA GGCGACCTGCTGGAACATT 560
  pullorum    
  equorum    
  canadensis    
Staphylococcus aureus AGGCGACTTTCTGGTCTGTAACTG CCGAAGGGGAAGGCTCTATCT 307
Haemophilus parasuis CCTTGGGAAAATACTGACGCTCAT TCCCGAAGGCACACTCTCAT 297
Chlamydia muridarum TGTTTAGTGGCGGAAGGGTTAG CCGTCCATTGCGAAAGATTC 304
  trachomatis    
Bacillus pumilus TGCAAGTCGAGCGGACAGA TCCCAGTCTTACAGGCAGGTTAC 91
  aerophilus    
  licheniformis    
  amyloliquefaciens    
  subtilis    
Bacillus II anthracis CGGCTTCGGCTGTCACTTATG TCAGCACTAAAGGGCGGAAAC 655
  cereus    
  thuringiensis    
Mycoplasma pneumoniae GAGGCGAACGGGTGAGTAACA CGCGACTGCTGGCACATAGT 441
  pirum    
  gallicepticum    
  genitalium    
  amphoriforme    
Leptospira borgpetersenii GGATAGCCCCGAGAGGTCATA CCATCATCACATCGCTGCTTAT 299
Leptospira meyeri CGAATGTGACGGTTCCTGGTAG TTCGCCCATTGAGCAAGATT 210
  biflexa    
Staphylococcus epidermidis GTGAAAGACGGTTTTGCTGTCAC CGGATAACGCTTGCCACCTAC 359
Streptococcus mitis GGAGCTTGCTCTTCTGGATGAG GAGCCGTTACCCCACCAACT 197
Leptospira interrogans CAGCCTGCACTTGAAACTATGTG ATAGTCCCCAGGCGGTCTACT 266
Brachyspira hyodysenteriae TGCCGTAGAGTGGGGGATAA CCGCAGGCTCATCGTAAAG 109
  aalborgi    
  intemedia    
  alvinipulli    
  innocens    
  suanatina    
Haemophilus influenzae CTTGCTTTCTTGCTGACGAGTG TCTCAGTCCCGCACTTTCATC 129
Candida I albicans CCAGCCGAGCCTTTCCTTCT TACCCCCGACCGTCCCTATT 187
  parapsilosis    
  dubliensis    
Candida tropicalis CGGTCGGGGGTATCAGTATTC ATACTCGCTGGCTCCGTCAGT 622