Skip to main content

Table 1 PCR primer of 14 ECM-related gene

From: ECM-related gene expression profile in vascular smooth muscle cells from human saphenous vein and internal thoracic artery

Primer name

Sequence (5’ → 3’)

Length of product

COL4A4/F

ACCCTGCCAGTCACTTTGGTC

103bp

COL4A4/R

ATACCAGGCAAGCCCTGCTC

COL11A1/F

AGCTGCAGGCCAAGATGGA

116bp

COL11A1/R

CAATCAGGCCAATTAAACCAGGA

FN-1/F

GAGCTGCACCTGTCTTGGGAAC

133bp

FN-1/R

GGAGCAAATGGCACCGAGATA

TNC/F

ACTCGCTACAAGCTGAAGGTGGA

122bp

TNC/R

GCACAGTTGGTGATGGATGAA

THBS/F

TGCTCCAATGCCACAGTTCC

132bp

THBS/R

CTGCTGAATTCCATTGCCACA

FBLN/F

CAACCTGCAGCAGCAGACGTGCTA

125bp

FBLN/R

AGCCAGGGTTCTCAGCAGGA

MMP3/F

GGGTGAGGACACCAGCATGA

178bp

MMP3/R

CAGAGTGTCGGAGTCCAGCTTC

MMP9/F

ACGCACGACGTCTTCCAGTA

94bp

MMP9/R

CCACCTGGTTCAACTCACTCC

TIMP-3/F

TGGCCAAGCTGGAGGTCAAC

75bp

TIMP-3/R

CCCGTGTACATCTTGCCATCATAG

WNT5A/F

TTCGCCCAGGTTGTAATTGAAG

168bp

WNT5A/R

CTGCATGTGGTCCTGATACAAGTG

SGCD/F

CTTGGCCATGACCATCTGGA

132bp

SGCD/R

GGCAGACTTGAAGTACAGGGCATTA

COL14A1/F

AAGCCCAGAGTCAAAGTTGTGGA

123bp

COL14A1/R

CCATGAACCATCGACCAGGA

ELN/F

AGCAAGACCTGGCTTCGGATT

122bp

ELN/R

CCAACGTTGATGAGGTCGTGA

PLAT/F

TCGAGACTCAAAGCCCTGGTG

119bp

PLAT/R

AGGCTGACCCATTCCCAAAGTAG

β-actin/F

CAACTGGGACGACATGGAGAAA

178bp

β-actin/R

GATAGCAACGTACATGGCTGGG