Skip to main content

Table 1 PCR primer of 14 ECM-related gene

From: ECM-related gene expression profile in vascular smooth muscle cells from human saphenous vein and internal thoracic artery

Primer name Sequence (5’ → 3’) Length of product
COL4A4/F ACCCTGCCAGTCACTTTGGTC 103bp
COL4A4/R ATACCAGGCAAGCCCTGCTC
COL11A1/F AGCTGCAGGCCAAGATGGA 116bp
COL11A1/R CAATCAGGCCAATTAAACCAGGA
FN-1/F GAGCTGCACCTGTCTTGGGAAC 133bp
FN-1/R GGAGCAAATGGCACCGAGATA
TNC/F ACTCGCTACAAGCTGAAGGTGGA 122bp
TNC/R GCACAGTTGGTGATGGATGAA
THBS/F TGCTCCAATGCCACAGTTCC 132bp
THBS/R CTGCTGAATTCCATTGCCACA
FBLN/F CAACCTGCAGCAGCAGACGTGCTA 125bp
FBLN/R AGCCAGGGTTCTCAGCAGGA
MMP3/F GGGTGAGGACACCAGCATGA 178bp
MMP3/R CAGAGTGTCGGAGTCCAGCTTC
MMP9/F ACGCACGACGTCTTCCAGTA 94bp
MMP9/R CCACCTGGTTCAACTCACTCC
TIMP-3/F TGGCCAAGCTGGAGGTCAAC 75bp
TIMP-3/R CCCGTGTACATCTTGCCATCATAG
WNT5A/F TTCGCCCAGGTTGTAATTGAAG 168bp
WNT5A/R CTGCATGTGGTCCTGATACAAGTG
SGCD/F CTTGGCCATGACCATCTGGA 132bp
SGCD/R GGCAGACTTGAAGTACAGGGCATTA
COL14A1/F AAGCCCAGAGTCAAAGTTGTGGA 123bp
COL14A1/R CCATGAACCATCGACCAGGA
ELN/F AGCAAGACCTGGCTTCGGATT 122bp
ELN/R CCAACGTTGATGAGGTCGTGA
PLAT/F TCGAGACTCAAAGCCCTGGTG 119bp
PLAT/R AGGCTGACCCATTCCCAAAGTAG
β-actin/F CAACTGGGACGACATGGAGAAA 178bp
β-actin/R GATAGCAACGTACATGGCTGGG