Skip to main content

Table 2 Description of commercially purchased RNA oligonucleotides used in standard curve and spike-in experiments

From: Circulating miRNAs reflect early myocardial injury and recovery after heart transplantation

miRNA Manufacturer of synthetic miRNA Synthetic miRNA (oligo) sequence
cel-miR-39 Shanghai GenePharma UCACCGGGUGUAAAUCAGCUUG
cel-miR-54 Shanghai GenePharma UACCCGUAAUCUUCAUAAUCCGAG
cel-miR-238 Shanghai GenePharma UUUGUACUCCGAUGCCAUUCAGA
hsa-miR-133a Shanghai GenePharma UUUGGUCCCCUUCAACCAGCUG
hsa-miR-208a Shanghai GenePharma AUAAGACGAGCAAAAAGCUUGU
hsa-miR-133b Shanghai GenePharma UUUGGUCCCCUUCAACCAGCUA