Skip to main content

Advertisement

Table 3 The primers of 13 genes

From: Expression of CLDN1 and CLDN10 in lung adenocarcinoma in situ and invasive lepidic predominant adenocarcinoma

Gene   Primer (5-3) Genbank Product size(bp)
CLDN7 Forward GGAGTGTCTAGATGCCTGAAA NM_001185022.1 118
  Reverse CCCAACCCAAGAGGACTATAC   
SMURF2 Forward AGAGTGCCCAGGGATCTTA NM_022739 91
  Reverse CTCTGCCTGTTGCCGTATTA   
CLDN1 Forward GATAGCAATCTTTGTGGCCACCGT NM_021101.4 205
  Reverse TTCGTACCTGGCATTGACTGGG   
C-FOS Forward CTTCCTGTTCCCAGCATCAT NM_005252.3 89
  Reverse CTGCATAGAAGGACCCAGATAG   
MET Forward AAATGTGTCGCTCCGTATCC NM_001127500.1 99
  Reverse GCACTATGATGTCTCCCAGAAG   
VCAM1 Forward AATGCCCATCTATGTCCCTTG NM_001199834.1 98
  Reverse ACTCCTCCAGTTCTCTCATCTT   
WIF1 Forward TAGAGGGAGAGCAGTGTGAA NM_007191.4 103
  Reverse CCCTGGTAACCTTTGGAACA   
FGFR1 Forward GGAGTTAATACCACCGACAAAGA NM_001174067 110
  Reverse TGGGAGAGTCCGATAGAGTTAC   
WNT2 Forward GCACCTAAAGCCTACCCTATTC NM_003391.2 92
  Reverse GCCTGTCATGCTATTTCCAAAG   
MMP2 Forward TGCTGAAGGACACACTAAAGAA NM_001127891.1 88
  Reverse CGCATGGTCTCGATGGTATT   
SOCS1 Forward CTTCTGTAGGATGGTAGCACAC NM_003745.1 98
  Reverse AGGAAGAGGAGGAAGGTTCT   
MUC4 Forward CTAAAGGTCACGTGGGTCAA NM_004532.5 120
  Reverse CTGGTAGAGAAACAGGGCATAG   
SP1 Forward GATGTGTGGGCTTCTGAGTTTA NM_001251825.1 100
  Reverse ACTGGCTGATGCTCCTTATTG