Skip to main content

Table 2 DNA and protein sequences for two positively selected phage clones

From: Screening and selection of peptides specific for esophageal cancer cells from a phage display peptide library

Clones DNA sequence Peptide sequence
P4 ACTCTAACTTACAGGATTACAATTACCCACATGATA RALAHPRDHPDL
P12 ATGCAGTTTCCATCTGGAGCAATGTGACCCTGCGGT ATCSMLLSRNEA