Skip to main content

Table 1 Quantitative real-time polymerase chain reaction (RT-qPCR) primers used in small and large animal models

From: Toll-like receptor 9 and the inflammatory response to surgical trauma and cardiopulmonary bypass

Gene Specific PrimerForwardReverse
Mouse
 Interleukin-6CCTCTGGTCTTCTGGAGTACCACTCCTTCTGTGACTCCAGC
 Cytochrome oxidase CAAAGTTGAACTGTACCCCTTAAGTCACTCATTTGTGCTCCTGTTCATC
Rodent
 Cytochrome oxidase CACATACCAAGGCCACCAACCAGAAAAATCCGGCAAAGAA
Pig
 Cytochrome oxidase CCCCATTATGATTGGGGGTTTTGCTGTGTATGCGTCAGGAT