Skip to main content

Table 1 The primer sequences of qRT-PCR

From: Effect of silencing C-erbB-2 on esophageal carcinoma cell biological behaviors by inhibiting IGF-1 pathway activation

Genes Sequences (5′-3′)
C-erbB-2 F: CCTCTGACGTCCATCATCTA
R: ATCTTCTGCTGCCGTCGCTT
IGF-1 F: GGATTTCAAGCAGAACTGTGTTTT
R: CCTGGACCTTGAATTTTTTCTTTTT
IGF-1R F: CCAAAACTGAAGCCGAGAAG
R: TGCACCTGTCGATATCGATG
Akt F: GAGCTGTTCTTCCACCTGTC
R: TAATGTGCCCGTCCTTGT
GAPDH F: CTCAGACACCATGGGGAAGGTGA
R: ATGATCTT2GAGGCTGTTGTCATA
  1. F forward, R reverse