Skip to main content

Table 1 Primer sequences of RT-qPCR

From: Predictive value and regulatory mechanism of serum miR-499a-5p on myocardial dysfunction in sepsis

  Forward primer (5′–3′) Reverse primer (5′–3′)
miR-451 GCCGAGCTTGGGAATGGC CTCAACTGGTGTCGTGGA
miR-378 GCCGAGAGGGCTCCTGAC CTCAACTGGTGTCGTGGA
miR-499a-5p GCCGAGGCCCTGTCCCCT CTCAACTGGTGTCGTGGA
EIF4E GACTGTCGAACCGGAAACCA AAACTTGGAGATCAGCCGCA
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GAPDH CAGTCACTACTCAGCTGCCA GAGGGTGCTCC GGTAG
  1. EIF4E, Eukaryotic initiation factor 4E; GAPDH, Glyceraldehyde-3-Phosphate Dehydrogenase