Skip to main content

Table 1 List of the designed primers

From: RhoA/rho-kinase, nitric oxide and inflammatory response in LIMA during OPCABG with isoflurane preconditioning

miR or mRNA Sequence(5′¬3′)
miR-221 F GCGACCACCTGGCATACAAT
miR-221 R GTGCAGGGTCCGAGGTATTC
miR-146 F GCGAGGTGAGAACTGAATTCCA
miR-146 R GTGCAGGGTCCGAGGTATTC
U6 F CTCGCTTCGGCAGCACA
U6 R AACGCTTCACGAATTTGCGT
NOS3 F TGTTTGTCTGCGGCGATGT
NOS3 R GGTGCGTATGCGGCTTGT
RhoA F GTGCCCACAGTGTTTGAGA
RhoA R ATCGGTATCTGGGTAGGAG
IKB-a F ATGAAAGACGAGGAGTACGAG
IKB-a R GCAGGTTGTTCTGGAAGTTGA
VCAM-1 F ATTTGACAGGCTGGAGATAGAC
VCAM-1 R CAGCCTGCCTTACTGTGGG
E-selectin F AGAGGCAGCAGTGATACCC
E-selectin R TGAGAAGCACCAAAGTGAGAG
ROK F TGACTGAGTGCCCTGTGGA
ROK R AACCCTGAAGCCTGTGATA
β-actin F CTTAGTTGCGTTACACCCTTTCTTG
β-actin R CTGTCACCTTCACCGTTCCAGTTT